Vidya's post, reffered me to a book called God's Debris. Half way through the book, simulated me to sit up and start typing down my views on GOD.

Well, I define GOD as my answer to facts that are unexplicable, to some chain of events to which I cannot relate any particular reason/person/groups of person etc, to some greater power, to whom I bow helplessly. For me GODs action, is the unexpected/unexplained chain of events that changes my life, that gives my mind clarity when I desperately seek it, that unexplainable feeling which boosts my confidence just before my exams when I silently say "GOD, just please only the stuuf I know should come in the exam".

The following example that I am going to use, is often told ( I guess, I dont quite recall who told me all this). GOD is the humanification of the unseen/unexplained forces of nature. This is what the PAGAN relegions were all about. Earliest man was afraid of fire, rain etc, he did not know how to use it, how to tame it, it always did him harm, and so to he personified FIRE as a GOD!

Further,I believe that GOD and relegion are not mutually inclusive. Each man , I believe should have his own GOD, his own definition of GOD, and his own set of private rules to be laid for his relationship with GOD, while religion on the other hand, is something which is COLLECTIVE.

The concepts of relegion, is a way to collectively rule people. Come to think of it, our relegion is just a set of rules which lays out how we should live in harmony with our fellow humans. It is like the CONSTITUTION of ancient kingdoms. Just like, two countries who do not agree with eachother on various issues, end up being in war, the different relegions of the world are in WAR.

Earlier politicians connected relegion to GOD, because if by doing so, they were able to make the common man believe that, they are living by a moral code of GOD, because of the fact that GOD was a personification of forces of which man was frightened. In the same light, festivals were 'invented' so that the king could give joy to his subjects, and concepts like sin/paap, punya etc were created, to give a "MORAL' man, his "CIVIL" codes.

I also believe, how this theory gels with some history, mainly that of the CHURCH repressing science, the stories of copernicus and galileo and all or that of ISLAM and its codes for women or caste system followed by the hindus etc etc.

afterall, if GOD were omni-present/potent etc etc, why should there be so mant definitions for that one thing which is all dominant and why are people fighting over which GOD is the real GOD.

what do you think?

in my a post, i mentioned about me teaching.

Well, this is about those two hours. I taught a girl in class 6, the basics of geometry, parallel lines, transversal, corresponding angles etc etc.

It was certainly a great experience, and one which has sprouted many a questions in my mind.

Well, I actually started off as a teacher, in the sense that i read her the definition and made her write it (my mom told me to do so....exam question, define transversal?) and then started stating the definition in simpler words with some illustrations and all...but then when i looked at that poor girls face, i just saw surprise. She was just blankly looking at me!

Then, I thought, part of the reason might be that, because those things were trivial for me, i just spoke at a frequency in which i understood, and this was probably my first lesson in teaching: Think like your student
From then on, I think i got a little better, (judging by the fact that her face showed some cognizance of facts like corresponding angles)

Slowly, as we drifted onto some more geometry and more relations like linear pair and some relations between angles, the little girls inquisitiveness got more and more, and this happens

Me (K): remember this, corresponding angles are always equal. Now which are the pairs of corresponding angles in this figure

My student (S): Why are corresponding angles equal?

K: Well, are you sure you want the proof ( i got a bit tense, because even though i knew it, the proof was not there in the book)

K: It is not very easy

S: Yes, Yes, that way i will never forget this theorem

K : (very tentatively start with the proof, and i was a bit rusty and made a couple of gaffes which i corrected, all in all i was not very convinvcing) you see, this angles add upto 180, and then this angle is equal to this, blah blah blah

S: ok ok ok bhaiyya...vaisee bhi book mein nahin hain....mujhe nahin seekhna!! aur syllabus mein bhi nahin hain

K was really very happy.

Apart from that, it was a good experience. I was lucky that the girl grasped the things quickly, but still learnt the virtue of being really patient!

one%2

No, this blog is not about the book or the movie ( both are fab though!)
Just a few minutes back, I agreed to teach my mother's student in 6th standard, Maths over the weekend. Also, I asked my mother to be on the look out for more such potential students, willing to learn maths from me on weekends.
So, tomorrow will be my first day as a teacher, and this is what my blog today is all about: It is going to be about teachers who have influenced my life in more ways than I can imagine, and it is going to be about those few teachers who have made me feel that 'Teaching' is the best job to be in.

I will start off reverse chronologically.
My first semester at IIT-B, I was taught "Computational Methods in ChE" by Prof. Patwardhan. And, from the first class he took, to the last class of his that I have attended (which was yesterday in another course offered by him), I have been mesmerized by him. He has incredeble knowledge in what he is teaching, is always so very sure of himself and explains the concepts in such a lucid way that you really do not have to go back home and read the stuff again, and all this to some of the most complicated subjects in the worlds. Some day when I become a professor, I would want to teach the way he does!

Another prof at IIT-B who taught me "Advanced Transport Phenomena", Prof Khakkar, is very special because and only because of his organization. Again, this was another class in which you just needed to pay attention and the concepts are clear. But, coming back to his organization, every class, he would clear the board, divide it into three, and start writing in the most beautiful of handwriting ever achieved by man on blackboard, and he would organize his writing in such a way that you need not have to look back in your notebook for that formula or proof, even if he had done it few classes earlie. Also, he had planned the course to the last detail. Sometimes, I have the feeling that he knew where he would start and stop each lecture.

Engineering college was not much of a special place. Most of the teachers there were not there because the liked to teach, but were there because it was just another 'job'. So, most of the classes were dull and boring and I hardly remember learning anything in the classes. But, one teacher in my engineering college stands out, not because he was a special teacher, but because he was there because he loved to teach. Mr. Kallur, was perhaps the most hated teacher in Chemical Engineering Department, RVCE. He had his own weird philosophy about almost everything ( I remember a class in which he compared a credit card to a suicide. He said, using a credit card is like killing yourself using the toughest nylon rope tied to the strongest branch of the strongest tree!!), was a strict disciplinarian (he would not tolerate a 30 second late entry to the class) and had a dislike for red (all the times I have been thrown out of his class, was when I wore a red shirt/t-shirt, pity red was my favorite colour). But, he sure loved teaching. He was not the most gifted of teachers, but would work hard and explain the concepts of the subjects he taught ( and the department more often than not assigned the toughest courses to him). Well, he is my inspiration because he taught because he loved to teach.

11th and 12th standard are pretty important time in a young students life. My fondest memories of studying in 12th standard in school are in my physics classes. Well, for me my 12th std physics teacher, Dr. P. Ghosh, is the face that comes to mind when someone talks about Feynman ( in 12th, i had not seen his photo, and somehow, based on rumors that Dr. Ghosh actually worked with Feynaman, I have attached him to Feynman permenantly). His classes were always filled with laughter and each topic he took up, there was an anecdote attached to it. More so, his method of explaining physics was so very unique and special, that I think, no one else can even come as much as copying 25% of his teaching style. ( I remember him going oh! irodovv baaba theke problem korabe amarke diye ( you are going to make me solve problem from irodov ( for those who dont know, Irodov has the toughest problems of elemenatary physics) amd then solve the most complicated of problems in a jiffy)))

I used to go to perhaps the worst place in India, promising to prepare students for IIT-JEE. But, even here, amongst the ordinary teachers, stood out one teacher. I still dont know his name, most of us at IIT-study circle, just know him by his initials, DN. He made me start "LOVE" mathematics. It was a pity that he did not teach us for long. But, his Co-ordinate geometry and Integration classes are the BEST classes I have ever been to.

I am probably very lucky to have had some really amazing teachers in junior school. Top of the list is my history teacher, Krishna Mam. I still love history.
Then are all my english teachers, Chanda mam, Sougata mam, who have created in me a huge hunger to read and read more and appreciate what I read and of lately write too ( equal credit to amma also!). Reading is one hobby that I am really proud off and of late I am feeling a bit sad that I am not "making" that much more time to read.
I believe that to anyone, their English and language teacher ( How can I forget Ganga mam) will be very important. I say so because, they teach liteature and interpret it to us, and in many ways, they interpret to us LIFE.
Finally in my list are two of my Geography teachers. Acchala madam and Sutoma mam. They taught with "PASSION", and that is all that I have to say about them. Those geography classes were the the most intersting classes in school.

I will die a satisfied person, if 20-30-40 years from now, a budding student writes a blog like this and includes Prof Kaushik there.

it feel so great....to go to sleep on a weekday without setting up the alarm!!

gonna wake up at 12 tomorow, have lunch and sleep again

happy republic day

and to any australian nut reading this shit

happy austalia day too!!!

I divide my dreams into three categories, depending on the time taken after I sleep for the dream to start.
1. This is just equivalent to day dreaming. When I do not feel really sleepy, but have nothing better to do but sleep, I just let my imagination paint beautiful pictures. Generally, I will start with a set of premises, like I get admitted to UW-Madison with aid, and then just let my imagination take it away. The granest such picture is that, I find a ultimate PhD group there, and we pass out and start a mega consulting group and rake in money @ of lakhs per day. I even fall in love with one of the females in the group and marry her!! or I am a huge rock star with a crazy fan followibng and I marry a hot fan of mine!!!

2. The second phase, is as rare as the first one is common. But then, this phase is really great and 99.999999% times hilarious. The only problem is that, rare they are, I also dont remember most of them. (had a dream which falls into this category today afternoon but i have forgotten it now). One that I vivdly remember is this:
I have to recieve someone at Mumbai VT station. SO, I tell my mom, that I will take a local to Chowpatty and walk from there. ( From where I stay, there is no train to chowpatty, and more chowpatty to V.T is not walkable). But, anyways, the dream proceeds and I find myself getting down at a non-existen chowpatty junction. The shock though is that instead of seeing chowpatty and marine drive, I see the beautiful marina beach in chennai. Still, not giving up, I change my plan to walk upto Chennai central. So, I start walking, and even more surprisingly, instead of the bridge over coovum ( i guess it is coovum, anyway the bridge on which aazuda azithu was shot) that should come if you decide to walk to central from marina, I am confronted by the howrah bridge of Kolkata. Even more surprisingly, the ever crowded bridge is magically empty and vendors have set up second hand book stalls for me to enjoy. As I slowly start to look at the books, I suddenly see myself trying to sell my ATM card to the vendor for 8 rupees.
At this point, my dbrain in deep sleep also realized that things were getting crazy and shut my dream factory to a stop.

3. This is the once-in-a-blue-moon type dream that I have. And, most of the time it is early in the morning. Log bolte hain naa, subah subah jo dekho woh sach ho jaata hai..., I hope it is true, because most of the dreams that I see at this time are really some events that I would love to have a chance of happening in my life ( and of the few of such dreams i have seen, i know some can happen only if a miracle takes place!)

Well, time to get to my dreams!

most horrible time, these last 2 hrs

have taken up a totally crazy subject called computational biology....

and believe me, by the end of this course, I will become an EXPERT in googling.

The first assignment is going from site to site to find out gene sequence of man, woman , child, dog , horse, bacteria, etc etc

and after 4-5 hrs of searching, the only great thing to happen was i found a MIT web page which had partial answers to all the assignment problems...

till next time
ATGCCGTAGGTCCCAATTGGCCAATGACGTACGTTTGCAATGCATGGTACCTTGAACCGGTTAAAAACGTGCATGTGAGT

to write?????...
today was nothin special
and right now i am just sitting here, wondering waht to write, but i want to write something.

Here are a few things that i want to write about, but at the moment am in no mood to write on
1. Are the IITs/IIMs too exclusive. Are the current selection process to these institutes the best one, given that an IIT engg grad starts of with a 5 lac package and one from a lukkha college has to do with 2-3 lacs.

2.The turning point in my life

3. How (mis)guiding are the profiles in blogger. On second thoughts, are they of any use? Now, am I going to connect to Mr/Ms X just because that person likes the same books, music and movies that I do.

4. Last few days, I have been reading an awesome number of blogs. The one commmon thing i have seen in most of the blogs is that the person writing it are avid readers. Is it that we feel like writng because we read a lot.

5. Kuch nahi likhna tha, lekin bahut likh diya:-D

Rite now listening to 1970s soft rock radio station on Yahoo Messenger. It sure is great!!! I have been dying to get a collection of these oldie english songs ( for free...not too much of a music freak to buy those....abhi ke liye free mein sun ke maze mein hoon)

that's all folks!

23rd jan 19??, is my pattis birthday. I guess no one in the family knows the exact year of her birthday. I think, even she would have guessed, i think i would be 75 (or 76) tomorrow, if there was a anyway i could connect heaven to talk to her.

I never remember celebrating her birthday. The only reason i remember the date is because it is netaji subash chandra bose's birthday ( and i remember that because it used to be a holiday in kolkata!)...

and when i think of patti, i guess i do not know much (anythin) about her.

My patti was like any lady of 1940-50-60s was, sacrificed everythin for marriage, husband , children, sincere to her family etc etc. I think this is one of the reason, that i know nothin about her childhood, ambitions etc. The only fact that has stood out is that she got 99/100 in her S.S.L.C. paper. ( i donno if she studied beyond that or not either)

Patti, was always a special person to me. Even more so, because i got to live with her only for 2 months in an year ( my grandparents preffered to stay in chennai and not in kolkata). So, every-year, those two months when the would visit us was always special to me. Right from the day, patti would come, I would sleep with her only. I would sit on her lap ( i even did it when i was in class 8), and chat non-stop with thatha, while he would sit in the porch reading his newspaper.
I remember, keeping time for patti, and always reminding her (even though she did not need any reminder) of taking her medicines for diabeties. I remember going for walks with her evey evening.
When my grandparents used to come, i just wished that school would end and i can get back to them.
And when it comes to south indian dishes, there can be no cook better than patti. The heavenly taste of her sambhars, sabjis, mambazam morkoyambu still lingers on with me.
The most important lesson, i have learnt from patti is the virtue of being calm. I have never never seen her angry. Infact, my sister and I would laugh out loud everytime my father would say that, patti used to scold him when he was a child.

The only thing i still rue is that I was not able to live upto their expectations while i was a kid. The thing is, I hardly remember beig a good boy to amma, i never came first in class (my thatha's dream), i never showed any special skills in extra curricular activities, never nothing.
And my biggest regret is that, now that I am shining ( atleast according to my school level standards), my grandparents are not there to see me do it. I regret that i will not be able to run into the house, clutching a report card saying that i have come first, and I regret that i will not be able to see the smile on their face and the satisfaction in their heart.....

But what i know is that they are looking after me and my family from heaven, and will always do

to patti and thatha!
my most favorite people in the world

Imagine you know that you are going to die in a week. How would you react? What would be the thoughts that will go through your mind, leading to that hour of reckoning.
What would you want to say to the people that matter most to you: your parents, dearest friends, family?
Whay would they say to you?
Would you repent your mistakes?
Would you resent yourself?
What would you do to free your mind of your guilt?
Would you CELEBRATE your life?

These are some of the questions that I started munching on after i finished watching tim robbins "dead man walking". This is a powerful movie about the final days of a person sentenced to life, and how a nun, leads him calmly to his death.
The performances are brilliant. Sean Penn as the convict is just mind blowing. Specially, the final moments. He has captured the emotions of a person who knows the exact second his breath will stop brilliantly. Towards the final scenes, his potrayal of accepting his guilt and all is GOD level!
Susan Sarandon has also given a powerful performance as the nun, and spiritual advisor of penn.
Truly, not only has the film elevated film making onto a different plane, it will make you, as the viewer, sit up and think.

One of the moments for me in the movie was when matthew's family had come to visit him for the one last time. Each one of them were trying to smile and trying to talk happy things, hoping to ease one another of their pains. Finally, when matthews mother talks about the inevitable, they just become quite. Then, they show the clock ticking away for somethin like two hours. The Silence said everything yet nothing. When finally the policeman come to tell that the time for visitin is over, mathhew shouts back telling there is still 15 minutes left. It was such a touching scene, a guy asking for 15 last minutes with his family.

well, i will leave you with a quote (read by susan sarandon from the bible)

Know the truth and the truth shall set you free

i just learnt (i seem totally stupid that it took me so long!) to post pictures and links on my blog, and I AM going to overdo it on this one!!!
tried it out 5 minutes ago, clicked preview, did not like the preview and clicked back again but the blog was missing, so gotta do it again.
Downside: was in the mood for writing two blogs back to back (to showcase all my newly learnt skills), but right now..mood chala gaya!!

anyways, back to the blog, ladies tennis is so beautiful, even more so when the powerful 'animal' tennis players: the williams sisters are OUT ( awesome!)...

just loved the lady who lost to davenport...kirilenko (plays well, looks great)



Hantuchova, i think is the most beautiful tennis player around! and to add to my happiness of just watching her play, she mothered serena today!!! (sone pe suhaga!!!)

i had always wanted to write a dairy for myself, but most of the time, i was too lazy to continue writing it. i have tried writing a diary everyyear since i reached class 6 (evey january, to be pecise when appa would get me a new diary), but hardly, i would have written for more than two or three days.

But still, i feel that 'writing' has been my best companion at the worst times. I always feel very relieved and refreshed whenver i write down whatever i feel during particularly hard times. I have had this habit since a long time, and usually i would just write in my note-books, rough books, pieces of paper etc and keep them stacked somewhere. And, then every once in a while, i would look into what i had written, feel stupid about what i had written and just throw the stuff away.

the same thing happened in college also. only, i managed to write on a lot more eclectic things. i had written on diaries, notebooks, train tickets, tissue papers, on tiny bus tickets. i also had been carrying these things in my wallet. On the last day of college, while i was pretending to clean my room and pack things up and leave, i started reading all that i had written, and was lost in all the moments that i wrote up those things, i had mostly bitter, but bitter-sweet memories of all the tiny incidents which led to make certain decisions, rue them later and finally write about it. It was an awesome journey that my mind took. Bu, later as morning dawned, i threw all of it away.

I threw them away, because i was leaving college, and i wanted to leave the 'memories' attached to those particular pieces of writing. But, I promised myself that i will not commit those mistakes again.

Today, inadvertently, i clicked the 'drafts' link on my email and found a mail lying in it. It was one of those writings which i mentioned i wanted to forget, but still there it was and it bought back a sea of memories, which i have been carefully avoiding for the past 8 months.

and the most amazing part was that i had left myself a comment in that 'mail':
kaushik, dont delete this, because this is one reminder of all the mistakes that you committed, and if you are suffering, it is beacuse you deserve it.

Which Hogwarts house will you be sorted into?

saw the movie 'the graduate' yesterday.
it was a different movie, and really made you think, and is also open to many interpretations.
here is mine
i think it is a story about how an indecisive young boys, who is continually being pushed around by others, discovers his 'independence'.
Ben (hoffman) is a young graduate who is under pressure from his own achievements, his over-demanding parents, his non-existent social life. In fact he is very unsure of himself (much like many of us). And as he is so unsure about himself, he allows others to take control of his life. it was shown subtely, as in when he could not persuade his father from stopping him to get into the pool, or when he had to ask elaine out and could not stop his parents from inviting the robinsons to their place. Even his affair with mrs robinson was under her control. Try as much as he did to take control in the relationship, he was always under mrs robinsons control.

So, when elaine came around and he really had feelings for her (this is where i think my interpretation is different), he started to take control of his life, he took decisions like going to berkely, chasing elaine from place to place and barging into her marraige etc etc, just shows how he changed his life.

and finally, i think this must have been written in almost anythin to do with this movie, but still, the music is just brilliant

simon and garfunkel ..............awesome

Rahul dravid has shown what leading by example means!!!!

His gesture of opening the batting himself, is I think one of the best leadership examples that I can think off.
As the captain, he could have asked people like VVS and yuvi to open (which they have done before), but instead he chose to brave the storm himself, thus giving out positive signs to his team-mates and also sending out a signal that when it comes to crunch situations and tough decisions, his team-mates must take cue from him and take on added responsibilities!!!

kudos to dravid

still related to cricket, thank god the stupid 4th umpire and cricket cafe is over, and some intelligent pre,mid and post match talking is taking place in straight drive.

here is a comment my imran khan during todays show

"it is great to HATE failure but it is foolish to FEAR failure"

we had our M.Tech projects alloted today.

There are two funny things associated with this that i would like to write about

1. The allotment process is such that every prof floats his/her topic and then the students are to take it according to a merit list. Well, the fac advisors also have to make sure that all the profs end up getting a student.
This sort of reminds me of team selection when we were young. Two captains were selected and the rest of us would stand in a line for the two captains to pick from, and all the people in the line would just be hoping that they are not the last to be selected!!!!! (for more elucidation on this concept, see the Wonder years, season 2 episode named 'loosiers'). Well, the profs were on such a line today!!!!!

2. If two students have the same CPI, and if they want the same project, it boils down to a coin toss!!!!!!
and today it was real fun (for all people except the two who were calling). So, the fac advisor suddenly became the match referree and we had inzy and dravid shaking hands in front of us. The prize: the project floated by prof Malik!!!

it is agonizing to be caught on the wrong side of the toss on such a placid wicket!!

but we enjoyed the rub of the green in 2004 when sehwag and sachin pelted the pakis around.....now it is their turn

i predict a similar result as that which india got in multan last time to the pakis this time!!

day before report in HIndustan times was about how some shiv sainiks went and pelted some stones and all on a shop in a Pune, just because they did not put up the name of the shop of in marathi.

Shiv sainiks are known to do this, but the larger picture is this the type of politics that we want to indulge in. State/ language sentiments is agreed, but to impose them on people is not at all correct. I have the right to live in any part of india, speak any language that i may wish to speak, and on my private property, put up signs in my language of choice (must not be obscene!!).
When the laws of the country are such, such antics by shiv sena should and must be questioned by the law (supreme court/high court)

One more point that facinates me, is that how do such tactics lead parties to power. I believe that any educated maharashtrian should discourage such insular and partisan views. Mumbai, what it is now is the collective effort of so many Indians and not of a few hundred maharashtrians.

However, all said and done, this tactics of manipulating language/regional sentiments is seen all over India.

The 60s saw ADMK/DMK rise to power in TN, based on the general apathy they created to moves by the central gorvernment to ensure that Hindi is learnt by everyone in school. Why, even recently, Jayalalitha demanded that Tamil also be one of the languages in which national documents are written when they are tabled in parliament etc (right now wnglish and hindi are used), based on an outrageous argument that this is done in singapore and malaysia!

Yesterday, Kiran Shaw of biocon, dealt another blow to karnataka govt. Hope Bangalore buckles up now and try to become the paradise it was once was!!!!

since september last year, I have been leading a half hostel-half ghar ka raja types lives.
My parents moved to mumbai, and so I have been spending week-ends at home.

The trouble though is, after enjoying mummy ka haath ka delicacies every sat-sun, it is hard for me to adjust to the crap served at the mess!!

forgive me if the spelling is wrong! i never quite figured out the correct spelling...try different versions every time!(google says spelling is right)

was attending a lecture yesterday, and the prof got philospohical and said
"it is amazing how people spend so much time and effort in trying to buy a cell-phone, but fall in love at first sight"

this got me thinking

i have this habit of deciding major events/things in my life in a jiffy, always just following what my heart says at that moment, and sometimes I have already made the decision and then I go through a long process of deliberations and taking opinions and what not!

just a couple of instances
I had not really thought about writing GATE ( the exam conducted for graduate courses at IIT), and actually focussed on geting myself on a plane to the US to do a PhD!, and my hard work in this regard and got myslelf an admit with aid to RPI!!
in the meantime i wrote GATE and surprised myslef with a All india rank of 112, and the next thing is that i am on a train to IIT-B for the interview.
This is where the amazing thing happens...I reach the department early in the morning for the interview, and just glance through the notice board and a board where the faculty publications are listed, and I tell my friend Badri that if I get through the interview, I will stay back in India and do M.Tech in IIT-B.
And after i got IIt-B, i followed it up with a whole lot of "discussion" with friends, seniors, teachers, relatives, and so many other people on what to do...go to US or go to IIT. But, as i think back, i knew all the time that i will go to IIT, and mostly i was trying to justify this (still some people think that i am a stupid to leave a rank 30 univ giving you $20,000p.a. for IIT).

another time is now, I decided that i will take up profV.P. proj while i was working on my seminar (really liked my seminar topic and he is the only prof working in that field), but after the topics where out and after I topped the class, I started to 'decide' on the project, because I was now in a position to choose the topic of a professor whose reccomendation is more valued than prof V.P.......whole of december wasted contacting the same bunch of people, and again trying to justify taking Prof V.P.

that brings me to the question
am I being rational or not, because i just seem to take important decisons in a jiffy, and then seem to validate it!!!.....(am I sounding crazy)

but then, it is my decision and it will be good until I start disliking it!!

confused soul

this is the title of a book, i read around two years ago. It is an well written book about the various emotions being captured by the authors in literature. The best part of the book was the quotes that the author used to illustrate his points.

Here is one which I can never forget.

"The world that I regard is myslef, it is the microcosm of my own frame that I cast my eye on; for the other, I use it but like my globe and turn it round sometimes for my recreation. Men that look upon my outside, perusing only my condition and fortunes, do err in my Altitude, for I am above Atlas his shoulders. The earth is a point, not only in respect of the Heavens above us, but of that Heavenly and Celestial part within us; that mass of flesh that circumscribes me, limits not my mind; that surface that tells the Heavens it hath an end, cannot persuade me that I have any; I take my circle to be above three hundred and sixty; though the number of the arc do measure my body, it comprehendeth not my mind; whilst I stufy to find how I ama Microcosm or little world, I find myself more than great. There is surely a piece of Divinity in us; something that was before the elements, and owes no homage unto the Sun."

i guess that is going to be my title for posts in which i have nothing to say!

well, i spent a couple of days thinking what shoud i write about in my next blog.....

frankly, i have been trying to write on topics so that i see some extravagent numbers in the comments column!! (justifies the last blog..but hey..i really believe in what i wrote)...

but now, i just suddenly think that MY blog is for myself to write any crap that I wish to write ( i just want to please myself)

so, right now, second semester just started and i am drifting from class to class trying to select the electives which are not much pain and where i can maximize a grade and a prof who can give a good reco..

one thing that has stuck me is that suddenly my 'tastes' as far as the subjects of my interest has changed drastically, i mean some topics which i was desperate to learn during my undergraduate, somehow do not interest me now (i am not even drifting into those classes!!!) and a subject which was not all that dear to me back then has become my first love...i dream of becoming a 'guru' in it!!
the more i think, i am not able to attribute any courses or such in my first sem here that made me change my mind

absolutely bewildering