most horrible time, these last 2 hrs

have taken up a totally crazy subject called computational biology....

and believe me, by the end of this course, I will become an EXPERT in googling.

The first assignment is going from site to site to find out gene sequence of man, woman , child, dog , horse, bacteria, etc etc

and after 4-5 hrs of searching, the only great thing to happen was i found a MIT web page which had partial answers to all the assignment problems...

till next time
ATGCCGTAGGTCCCAATTGGCCAATGACGTACGTTTGCAATGCATGGTACCTTGAACCGGTTAAAAACGTGCATGTGAGT