11:55 AM |
Author: kaushik
Vidya's post, reffered me to a book called
God's Debris. Half way through the book, simulated me to sit up and start typing down my views on GOD.
Well, I define GOD as my answer to facts that are unexplicable, to some chain of events to which I cannot relate any particular reason/person/groups of person etc, to some greater power, to whom I bow helplessly. For me GODs action, is the unexpected/unexplained chain of events that changes my life, that gives my mind clarity when I desperately seek it, that unexplainable feeling which boosts my confidence just before my exams when I silently say "GOD, just please only the stuuf I know should come in the exam".
The following example that I am going to use, is often told ( I guess, I dont quite recall who told me all this). GOD is the humanification of the unseen/unexplained forces of nature. This is what the PAGAN relegions were all about. Earliest man was afraid of fire, rain etc, he did not know how to use it, how to tame it, it always did him harm, and so to he personified FIRE as a GOD!
Further,I believe that GOD and relegion are not mutually inclusive. Each man , I believe should have his own GOD, his own definition of GOD, and his own set of private rules to be laid for his relationship with GOD, while religion on the other hand, is something which is COLLECTIVE.
The concepts of relegion, is a way to collectively rule people. Come to think of it, our relegion is just a set of rules which lays out how we should live in harmony with our fellow humans. It is like the CONSTITUTION of ancient kingdoms. Just like, two countries who do not agree with eachother on various issues, end up being in war, the different relegions of the world are in WAR.
Earlier politicians connected relegion to GOD, because if by doing so, they were able to make the common man believe that, they are living by a moral code of GOD, because of the fact that GOD was a personification of forces of which man was frightened. In the same light, festivals were 'invented' so that the king could give joy to his subjects, and concepts like sin/paap, punya etc were created, to give a "MORAL' man, his "CIVIL" codes.
I also believe, how this theory gels with some history, mainly that of the CHURCH repressing science, the stories of copernicus and galileo and all or that of ISLAM and its codes for women or caste system followed by the hindus etc etc.
afterall, if GOD were omni-present/potent etc etc, why should there be so mant definitions for that one thing which is all dominant and why are people fighting over which GOD is the real GOD.
what do you think?
Category:
|
11:04 AM |
Author: kaushik
in my a post, i mentioned about me teaching.
Well, this is about those two hours. I taught a girl in class 6, the basics of geometry, parallel lines, transversal, corresponding angles etc etc.
It was certainly a great experience, and one which has sprouted many a questions in my mind.
Well, I actually started off as a teacher, in the sense that i read her the definition and made her write it (my mom told me to do so....exam question, define transversal?) and then started stating the definition in simpler words with some illustrations and all...but then when i looked at that poor girls face, i just saw surprise. She was just blankly looking at me!
Then, I thought, part of the reason might be that, because those things were trivial for me, i just spoke at a frequency in which i understood, and this was probably my first lesson in teaching: Think like your student
From then on, I think i got a little better, (judging by the fact that her face showed some cognizance of facts like corresponding angles)
Slowly, as we drifted onto some more geometry and more relations like linear pair and some relations between angles, the little girls inquisitiveness got more and more, and this happens
Me (K): remember this, corresponding angles are always equal. Now which are the pairs of corresponding angles in this figure
My student (S): Why are corresponding angles equal?
K: Well, are you sure you want the proof ( i got a bit tense, because even though i knew it, the proof was not there in the book)
K: It is not very easy
S: Yes, Yes, that way i will never forget this theorem
K : (very tentatively start with the proof, and i was a bit rusty and made a couple of gaffes which i corrected, all in all i was not very convinvcing) you see, this angles add upto 180, and then this angle is equal to this, blah blah blah
S: ok ok ok bhaiyya...vaisee bhi book mein nahin hain....mujhe nahin seekhna!! aur syllabus mein bhi nahin hain
K was really very happy.
Apart from that, it was a good experience. I was lucky that the girl grasped the things quickly, but still learnt the virtue of being really patient!
one%2
Category:
|
7:08 AM |
Author: kaushik
No, this blog is not about the book or the movie ( both are fab though!)
Just a few minutes back, I agreed to teach my mother's student in 6th standard, Maths over the weekend. Also, I asked my mother to be on the look out for more such potential students, willing to learn maths from me on weekends.
So, tomorrow will be my first day as a teacher, and this is what my blog today is all about: It is going to be about teachers who have influenced my life in more ways than I can imagine, and it is going to be about those few teachers who have made me feel that 'Teaching' is the best job to be in.
I will start off reverse chronologically.
My first semester at IIT-B, I was taught "Computational Methods in ChE" by Prof. Patwardhan. And, from the first class he took, to the last class of his that I have attended (which was yesterday in another course offered by him), I have been mesmerized by him. He has incredeble knowledge in what he is teaching, is always so very sure of himself and explains the concepts in such a lucid way that you really do not have to go back home and read the stuff again, and all this to some of the most complicated subjects in the worlds. Some day when I become a professor, I would want to teach the way he does!
Another prof at IIT-B who taught me "Advanced Transport Phenomena", Prof Khakkar, is very special because and only because of his organization. Again, this was another class in which you just needed to pay attention and the concepts are clear. But, coming back to his organization, every class, he would clear the board, divide it into three, and start writing in the most beautiful of handwriting ever achieved by man on blackboard, and he would organize his writing in such a way that you need not have to look back in your notebook for that formula or proof, even if he had done it few classes earlie. Also, he had planned the course to the last detail. Sometimes, I have the feeling that he knew where he would start and stop each lecture.
Engineering college was not much of a special place. Most of the teachers there were not there because the liked to teach, but were there because it was just another 'job'. So, most of the classes were dull and boring and I hardly remember learning anything in the classes. But, one teacher in my engineering college stands out, not because he was a special teacher, but because he was there because he loved to teach. Mr. Kallur, was perhaps the most hated teacher in Chemical Engineering Department, RVCE. He had his own weird philosophy about almost everything ( I remember a class in which he compared a credit card to a suicide. He said, using a credit card is like killing yourself using the toughest nylon rope tied to the strongest branch of the strongest tree!!), was a strict disciplinarian (he would not tolerate a 30 second late entry to the class) and had a dislike for red (all the times I have been thrown out of his class, was when I wore a red shirt/t-shirt, pity red was my favorite colour). But, he sure loved teaching. He was not the most gifted of teachers, but would work hard and explain the concepts of the subjects he taught ( and the department more often than not assigned the toughest courses to him). Well, he is my inspiration because he taught because he loved to teach.
11th and 12th standard are pretty important time in a young students life. My fondest memories of studying in 12th standard in school are in my physics classes. Well, for me my 12th std physics teacher, Dr. P. Ghosh, is the face that comes to mind when someone talks about Feynman ( in 12th, i had not seen his photo, and somehow, based on rumors that Dr. Ghosh actually worked with Feynaman, I have attached him to Feynman permenantly). His classes were always filled with laughter and each topic he took up, there was an anecdote attached to it. More so, his method of explaining physics was so very unique and special, that I think, no one else can even come as much as copying 25% of his teaching style. ( I remember him going oh! irodovv baaba theke problem korabe amarke diye ( you are going to make me solve problem from irodov ( for those who dont know, Irodov has the toughest problems of elemenatary physics) amd then solve the most complicated of problems in a jiffy)))
I used to go to perhaps the worst place in India, promising to prepare students for IIT-JEE. But, even here, amongst the ordinary teachers, stood out one teacher. I still dont know his name, most of us at IIT-study circle, just know him by his initials, DN. He made me start "LOVE" mathematics. It was a pity that he did not teach us for long. But, his Co-ordinate geometry and Integration classes are the BEST classes I have ever been to.
I am probably very lucky to have had some really amazing teachers in junior school. Top of the list is my history teacher, Krishna Mam. I still love history.
Then are all my english teachers, Chanda mam, Sougata mam, who have created in me a huge hunger to read and read more and appreciate what I read and of lately write too ( equal credit to amma also!). Reading is one hobby that I am really proud off and of late I am feeling a bit sad that I am not "making" that much more time to read.
I believe that to anyone, their English and language teacher ( How can I forget Ganga mam) will be very important. I say so because, they teach liteature and interpret it to us, and in many ways, they interpret to us LIFE.
Finally in my list are two of my Geography teachers. Acchala madam and Sutoma mam. They taught with "PASSION", and that is all that I have to say about them. Those geography classes were the the most intersting classes in school.
I will die a satisfied person, if 20-30-40 years from now, a budding student writes a blog like this and includes Prof Kaushik there.
Category:
|
1:07 PM |
Author: kaushik
it feel so great....to go to sleep on a weekday without setting up the alarm!!
gonna wake up at 12 tomorow, have lunch and sleep again
happy republic day
and to any australian nut reading this shit
happy austalia day too!!!
Category:
|
6:56 AM |
Author: kaushik
I divide my dreams into three categories, depending on the time taken after I sleep for the dream to start.
1. This is just equivalent to day dreaming. When I do not feel really sleepy, but have nothing better to do but sleep, I just let my imagination paint beautiful pictures. Generally, I will start with a set of premises, like I get admitted to UW-Madison with aid, and then just let my imagination take it away. The granest such picture is that, I find a ultimate PhD group there, and we pass out and start a mega consulting group and rake in money @ of lakhs per day. I even fall in love with one of the females in the group and marry her!! or I am a huge rock star with a crazy fan followibng and I marry a hot fan of mine!!!
2. The second phase, is as rare as the first one is common. But then, this phase is really great and 99.999999% times hilarious. The only problem is that, rare they are, I also dont remember most of them. (had a dream which falls into this category today afternoon but i have forgotten it now). One that I vivdly remember is this:
I have to recieve someone at Mumbai VT station. SO, I tell my mom, that I will take a local to Chowpatty and walk from there. ( From where I stay, there is no train to chowpatty, and more chowpatty to V.T is not walkable). But, anyways, the dream proceeds and I find myself getting down at a non-existen chowpatty junction. The shock though is that instead of seeing chowpatty and marine drive, I see the beautiful marina beach in chennai. Still, not giving up, I change my plan to walk upto Chennai central. So, I start walking, and even more surprisingly, instead of the bridge over coovum ( i guess it is coovum, anyway the bridge on which aazuda azithu was shot) that should come if you decide to walk to central from marina, I am confronted by the howrah bridge of Kolkata. Even more surprisingly, the ever crowded bridge is magically empty and vendors have set up second hand book stalls for me to enjoy. As I slowly start to look at the books, I suddenly see myself trying to sell my ATM card to the vendor for 8 rupees.
At this point, my dbrain in deep sleep also realized that things were getting crazy and shut my dream factory to a stop.
3. This is the once-in-a-blue-moon type dream that I have. And, most of the time it is early in the morning. Log bolte hain naa, subah subah jo dekho woh sach ho jaata hai..., I hope it is true, because most of the dreams that I see at this time are really some events that I would love to have a chance of happening in my life ( and of the few of such dreams i have seen, i know some can happen only if a miracle takes place!)
Well, time to get to my dreams!
Category:
|
11:54 AM |
Author: kaushik
most horrible time, these last 2 hrs
have taken up a totally crazy subject called computational biology....
and believe me, by the end of this course, I will become an EXPERT in googling.
The first assignment is going from site to site to find out gene sequence of man, woman , child, dog , horse, bacteria, etc etc
and after 4-5 hrs of searching, the only great thing to happen was i found a MIT web page which had partial answers to all the assignment problems...
till next time
ATGCCGTAGGTCCCAATTGGCCAATGACGTACGTTTGCAATGCATGGTACCTTGAACCGGTTAAAAACGTGCATGTGAGT
Category:
|
11:26 AM |
Author: kaushik
to write?????...
today was nothin special
and right now i am just sitting here, wondering waht to write, but i want to write something.
Here are a few things that i want to write about, but at the moment am in no mood to write on
1. Are the IITs/IIMs too exclusive. Are the current selection process to these institutes the best one, given that an IIT engg grad starts of with a 5 lac package and one from a lukkha college has to do with 2-3 lacs.
2.The turning point in my life
3. How (mis)guiding are the profiles in blogger. On second thoughts, are they of any use? Now, am I going to connect to Mr/Ms X just because that person likes the same books, music and movies that I do.
4. Last few days, I have been reading an awesome number of blogs. The one commmon thing i have seen in most of the blogs is that the person writing it are avid readers. Is it that we feel like writng because we read a lot.
5. Kuch nahi likhna tha, lekin bahut likh diya:-D
Rite now listening to 1970s soft rock radio station on Yahoo Messenger. It sure is great!!! I have been dying to get a collection of these oldie english songs ( for free...not too much of a music freak to buy those....abhi ke liye free mein sun ke maze mein hoon)
that's all folks!
Category:
|