11:54 AM |
Author: kaushik
most horrible time, these last 2 hrs
have taken up a totally crazy subject called computational biology....
and believe me, by the end of this course, I will become an EXPERT in googling.
The first assignment is going from site to site to find out gene sequence of man, woman , child, dog , horse, bacteria, etc etc
and after 4-5 hrs of searching, the only great thing to happen was i found a MIT web page which had partial answers to all the assignment problems...
till next time
ATGCCGTAGGTCCCAATTGGCCAATGACGTACGTTTGCAATGCATGGTACCTTGAACCGGTTAAAAACGTGCATGTGAGT
have taken up a totally crazy subject called computational biology....
and believe me, by the end of this course, I will become an EXPERT in googling.
The first assignment is going from site to site to find out gene sequence of man, woman , child, dog , horse, bacteria, etc etc
and after 4-5 hrs of searching, the only great thing to happen was i found a MIT web page which had partial answers to all the assignment problems...
till next time
ATGCCGTAGGTCCCAATTGGCCAATGACGTACGTTTGCAATGCATGGTACCTTGAACCGGTTAAAAACGTGCATGTGAGT

0 comments: